Review



12216 experimental models  (TaKaRa)


Bioz Verified Symbol TaKaRa is a verified supplier
Bioz Manufacturer Symbol TaKaRa manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 97
      Buy from Supplier

    Structured Review

    TaKaRa 12216 experimental models
    12216 Experimental Models, supplied by TaKaRa, used in various techniques. Bioz Stars score: 97/100, based on 1466 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/12216+experimental+models/Stellar+Competent+Cells/pm31231038-329-97-106
    Average 97 stars, based on 1466 article reviews
    12216 experimental models - by Bioz Stars, 2026-09
    97/100 stars

    Images

    Related Articles

    Transfection:

    Article Title: Multimerization and Retention of the Scavenger Receptor SR-B1 in the Plasma Membrane.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies SR-B1, rabbit monoclonal Abcam Clone: EPI556Y; Cat# ab52629; RRID: AB_882458 b-Actin, mouse monoclonal Sigma-Aldrich Clone: AC-15; Cat# A1978; RRID: AB_476692 Clathrin heavy chain, mouse monoclonal Abcam Clone: X-22; Cat# ab2731; RRID: AB_303256 Caveolin-1, rabbit polyclonal BD Biosciences Cat# 610059; RRID: AB_397471 6His, mouse monoclonal Biolegend Clone: 6-His; Cat# 906101; RRID: AB_2565061 NHERF1, rabbit polyclonal Atlas Antibodies Cat# HPA027247; RRID: AB_10601162 NHERF2, rabbit polyclonal Atlas Antibodies Cat# HPA001672; RRID: AB_1080017 Ezrin, mouse monoclonal Thermo Fisher Clone: 3C12; Cat# MA5-13862; RRID: AB_10979020 Goat anti-rabbit IRDye 680RD LI-COR Cat# 925–68071; RRID: AB_2721181 Donkey anti-mouse IRDye 800CW LI-COR Cat# 925-32212; RRID: AB_2716622 CD81, hamster monoclonal Thermo Fisher Clone: Eat2; Cat# MA180209; RRID: AB_929499 Tfn-R, mouse monoclonal Thermo Fisher Clone: H68.4; Cat# 13-6800; RRID: AB_2533029 Chemicals, Peptides, and Recombinant Proteins Single-chain variable fragment (ScFv) This paper Based on mAb IgG C167 from Catanese et al., 2007 Human transferrin-AF488 Thermo Fisher Cat# T13342 Cholera Toxin B-AF488 Thermo Fisher Cat# C34775 FM 4–64 Thermo Fisher Cat# T13320 Anti GFP-binding protein (VHH, nanobody) Chromotek Cat# gt-250 Methyl-b-cyclodextrin (MbCD) Sigma-Aldrich Cat# C4555 2-bromopalmitate (2-BP) Sigma-Aldrich Cat# 238422 Latrunculin B Sigma-Aldrich Cat# L5288 Human HDL Kalen Biomedical Cat# 770300-4 Human LDL Kalen Biomedical Cat# 770200-4 Nile Red Thermo Fisher Cat# N3013 Ezrin Inhibitor Calbiochem Cat# NSC668394 Triton X-100 Fisher Scientific Cat# BP151-500 DAPI Thermo Fisher Cat# D1306 Hoechst 33258 Thermo Fisher Cat# H21491 Cy3B NHS ester GE Healthcare Cat# PA63101 DyLight 650 NHS ester Thermo Fisher Cat# 62265 Alexa Fluor 488 (AF488) NHS ester Thermo Fisher Cat# A20000 Top-Fluor Cholesterol Avanti Polar Lipids Cat# 810255 Nile Red Sigma-Aldrich Cat# N3013 Acti-Stain 670 Phalloidin Cytoskeleton Cat# PHDN1 ProLong Diamond Antifade mountant Thermo Fisher Cat# P36961 Oligomers ACGT Corporation N/A CloneAmp Hifi PCR premix Takara Cat# 638500 DpnI restriction enzyme New England Biolabs Cat# R0176S 2-mercaptoethanesulfonate (MESNA) Sigma-Aldrich Cat# 63705 Wheat germ agglutinin (WGA)-AF647 Thermo Fisher Cat# W32466 Critical Commercial Assays GeneJet RNA Purification Kit Thermo Fisher Cat# K0731 Superscript VILO cDNA synthesis Kit Thermo Fisher Cat# 11754-010 (Continued on next page) e1 Developmental Cell 50, 1–13.e1–e5, August 5, 2019 .. REAGENT or RESOURCE SOURCE IDENTIFIER Lipofectamine LTX with Plus Reagent Thermo Fisher Cat# 15338100 FuGENE 6 Transfection Reagent Promega Cat# E2691 VIROMER Blue Transfection Reagent Lipocalyx Cat# VB-01LB-00 Taqman Fast Advanced Master Mix Thermo Fisher Cat# 4444557 QIAquick PCR purification kit Qiagen Cat# 28104 In-Fusion HD EcoDry cloning kit Takara Cat# 639690 Pierce Cell Surface Protein Isolation kit Thermo Fisher Cat# 89881 Experimental Models: Cell Lines Human female NCI-H295R ATCC Cat# CRL-2128 Hamster female CHO-K1 ATCC Cat# CCL-61 Human male HepG2 ATCC Cat# HB-8065 Human HAMEC (sex not known) ScienCell Cat# 7200 Human male HDLEC PromoCell Cat# C-12216 Experimental Models: Organisms/Strains Escherichia coli Stellar Competent Cells Clontech Cat# 636763 Oligonucleotides TaqMan gene expression assay total SR-B1 Thermo Fisher Cat# Hs00969821_m1 Custom TaqMan gene expression assay SR-B1 canonical: Forward: actatgcccagtacgtcctcctg; Reverse: ctccaaaataaatagcatttctcttggctccgg Thermo Fisher N/A Custom TaqMan gene expression assay SR-B1.1: Forward: actatgcccagtacgtcctcctg; Reverse: gtcctcaggaccttggctccgga Thermo Fisher N/A TaqMan gene expression assay CD81 Thermo Fisher Cat# Hs01002167_m1 TaqMan gene expression assay CDKN1A Thermo Fisher Cat# Hs00355782_m1 SR-B1 Stealth siRNA Thermo Fisher Cat# HSS101570 CD81 Stealth siRNA Thermo Fisher Cat# HSS101629 Stealth RNAi negative control duplexes Thermo Fisher Cat# 12935300 Recombinant DNA SR-B1-GFP Neculai et al., 2013 N/A SR-B1.1-GFP This paper N/A SR-B1 Neculai et al., 2013 N/A SR-B1.1 This paper N/A GFP-TMC This paper N/A GFP-TMC.1 This paper N/A SR-B1 PALM-/- This paper N/A SR-B1 MYRI-/- This paper N/A SR-B1 L413A This paper N/A SR-B1 L413A/L427A This paper N/A SR-B1 L441A/L448A/L455A This paper N/A SR-B1 G15L/G18L/G25L This paper N/A VapB-mCherry Zewe et al., 2018 Addgene D4H-mCherry Maekawa and Fairn, 2015 N/A Clathrin light chain-GFP Gaidarov et al., 1999 N/A tdEos-SR-B1 This paper N/A Software and Algorithms Volocity Perkin Elmer http://cellularimaging.perkinelmer.com/downloads/ detail.php?id=14 GraphPad Prism GraphPad Software https://www.graphpad.com/scientific-software/ prism/ (Continued on next page) Developmental Cell 50, 1–13.e1–e5, August 5, 2019 e2 .. REAGENT or RESOURCE SOURCE IDENTIFIER MATLAB MathWorks https://www.mathworks.com/products/matlab.html u-Track single particle tracking software Jaqaman et al., 2011 https://www.utsouthwestern.edu/labs/danuser/ software/ Huygens Professional Scientific Volume Imaging https://svi.nl/Huygens-Professional Zen software Zeiss https://www.zeiss.com/microscopy/int/products/ microscope-software/zen-lite.html Other ITS+Premix Culture Supplement Corning Cat# 354352 ECM medium ScienCell Cat# 1001 ECGM-MV2 medium PromoCell Cat# C-22022 Antibiotic-Antimycotic Solution (100x) Multicell Cat# 450-115-EL Chamlide Magnetic Chambers Live Cell Instrument Cat# CM-B18-1

    Polymerase Chain Reaction:

    Article Title: Multimerization and Retention of the Scavenger Receptor SR-B1 in the Plasma Membrane.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies SR-B1, rabbit monoclonal Abcam Clone: EPI556Y; Cat# ab52629; RRID: AB_882458 b-Actin, mouse monoclonal Sigma-Aldrich Clone: AC-15; Cat# A1978; RRID: AB_476692 Clathrin heavy chain, mouse monoclonal Abcam Clone: X-22; Cat# ab2731; RRID: AB_303256 Caveolin-1, rabbit polyclonal BD Biosciences Cat# 610059; RRID: AB_397471 6His, mouse monoclonal Biolegend Clone: 6-His; Cat# 906101; RRID: AB_2565061 NHERF1, rabbit polyclonal Atlas Antibodies Cat# HPA027247; RRID: AB_10601162 NHERF2, rabbit polyclonal Atlas Antibodies Cat# HPA001672; RRID: AB_1080017 Ezrin, mouse monoclonal Thermo Fisher Clone: 3C12; Cat# MA5-13862; RRID: AB_10979020 Goat anti-rabbit IRDye 680RD LI-COR Cat# 925–68071; RRID: AB_2721181 Donkey anti-mouse IRDye 800CW LI-COR Cat# 925-32212; RRID: AB_2716622 CD81, hamster monoclonal Thermo Fisher Clone: Eat2; Cat# MA180209; RRID: AB_929499 Tfn-R, mouse monoclonal Thermo Fisher Clone: H68.4; Cat# 13-6800; RRID: AB_2533029 Chemicals, Peptides, and Recombinant Proteins Single-chain variable fragment (ScFv) This paper Based on mAb IgG C167 from Catanese et al., 2007 Human transferrin-AF488 Thermo Fisher Cat# T13342 Cholera Toxin B-AF488 Thermo Fisher Cat# C34775 FM 4–64 Thermo Fisher Cat# T13320 Anti GFP-binding protein (VHH, nanobody) Chromotek Cat# gt-250 Methyl-b-cyclodextrin (MbCD) Sigma-Aldrich Cat# C4555 2-bromopalmitate (2-BP) Sigma-Aldrich Cat# 238422 Latrunculin B Sigma-Aldrich Cat# L5288 Human HDL Kalen Biomedical Cat# 770300-4 Human LDL Kalen Biomedical Cat# 770200-4 Nile Red Thermo Fisher Cat# N3013 Ezrin Inhibitor Calbiochem Cat# NSC668394 Triton X-100 Fisher Scientific Cat# BP151-500 DAPI Thermo Fisher Cat# D1306 Hoechst 33258 Thermo Fisher Cat# H21491 Cy3B NHS ester GE Healthcare Cat# PA63101 DyLight 650 NHS ester Thermo Fisher Cat# 62265 Alexa Fluor 488 (AF488) NHS ester Thermo Fisher Cat# A20000 Top-Fluor Cholesterol Avanti Polar Lipids Cat# 810255 Nile Red Sigma-Aldrich Cat# N3013 Acti-Stain 670 Phalloidin Cytoskeleton Cat# PHDN1 ProLong Diamond Antifade mountant Thermo Fisher Cat# P36961 Oligomers ACGT Corporation N/A CloneAmp Hifi PCR premix Takara Cat# 638500 DpnI restriction enzyme New England Biolabs Cat# R0176S 2-mercaptoethanesulfonate (MESNA) Sigma-Aldrich Cat# 63705 Wheat germ agglutinin (WGA)-AF647 Thermo Fisher Cat# W32466 Critical Commercial Assays GeneJet RNA Purification Kit Thermo Fisher Cat# K0731 Superscript VILO cDNA synthesis Kit Thermo Fisher Cat# 11754-010 (Continued on next page) e1 Developmental Cell 50, 1–13.e1–e5, August 5, 2019 .. REAGENT or RESOURCE SOURCE IDENTIFIER Lipofectamine LTX with Plus Reagent Thermo Fisher Cat# 15338100 FuGENE 6 Transfection Reagent Promega Cat# E2691 VIROMER Blue Transfection Reagent Lipocalyx Cat# VB-01LB-00 Taqman Fast Advanced Master Mix Thermo Fisher Cat# 4444557 QIAquick PCR purification kit Qiagen Cat# 28104 In-Fusion HD EcoDry cloning kit Takara Cat# 639690 Pierce Cell Surface Protein Isolation kit Thermo Fisher Cat# 89881 Experimental Models: Cell Lines Human female NCI-H295R ATCC Cat# CRL-2128 Hamster female CHO-K1 ATCC Cat# CCL-61 Human male HepG2 ATCC Cat# HB-8065 Human HAMEC (sex not known) ScienCell Cat# 7200 Human male HDLEC PromoCell Cat# C-12216 Experimental Models: Organisms/Strains Escherichia coli Stellar Competent Cells Clontech Cat# 636763 Oligonucleotides TaqMan gene expression assay total SR-B1 Thermo Fisher Cat# Hs00969821_m1 Custom TaqMan gene expression assay SR-B1 canonical: Forward: actatgcccagtacgtcctcctg; Reverse: ctccaaaataaatagcatttctcttggctccgg Thermo Fisher N/A Custom TaqMan gene expression assay SR-B1.1: Forward: actatgcccagtacgtcctcctg; Reverse: gtcctcaggaccttggctccgga Thermo Fisher N/A TaqMan gene expression assay CD81 Thermo Fisher Cat# Hs01002167_m1 TaqMan gene expression assay CDKN1A Thermo Fisher Cat# Hs00355782_m1 SR-B1 Stealth siRNA Thermo Fisher Cat# HSS101570 CD81 Stealth siRNA Thermo Fisher Cat# HSS101629 Stealth RNAi negative control duplexes Thermo Fisher Cat# 12935300 Recombinant DNA SR-B1-GFP Neculai et al., 2013 N/A SR-B1.1-GFP This paper N/A SR-B1 Neculai et al., 2013 N/A SR-B1.1 This paper N/A GFP-TMC This paper N/A GFP-TMC.1 This paper N/A SR-B1 PALM-/- This paper N/A SR-B1 MYRI-/- This paper N/A SR-B1 L413A This paper N/A SR-B1 L413A/L427A This paper N/A SR-B1 L441A/L448A/L455A This paper N/A SR-B1 G15L/G18L/G25L This paper N/A VapB-mCherry Zewe et al., 2018 Addgene D4H-mCherry Maekawa and Fairn, 2015 N/A Clathrin light chain-GFP Gaidarov et al., 1999 N/A tdEos-SR-B1 This paper N/A Software and Algorithms Volocity Perkin Elmer http://cellularimaging.perkinelmer.com/downloads/ detail.php?id=14 GraphPad Prism GraphPad Software https://www.graphpad.com/scientific-software/ prism/ (Continued on next page) Developmental Cell 50, 1–13.e1–e5, August 5, 2019 e2 .. REAGENT or RESOURCE SOURCE IDENTIFIER MATLAB MathWorks https://www.mathworks.com/products/matlab.html u-Track single particle tracking software Jaqaman et al., 2011 https://www.utsouthwestern.edu/labs/danuser/ software/ Huygens Professional Scientific Volume Imaging https://svi.nl/Huygens-Professional Zen software Zeiss https://www.zeiss.com/microscopy/int/products/ microscope-software/zen-lite.html Other ITS+Premix Culture Supplement Corning Cat# 354352 ECM medium ScienCell Cat# 1001 ECGM-MV2 medium PromoCell Cat# C-22022 Antibiotic-Antimycotic Solution (100x) Multicell Cat# 450-115-EL Chamlide Magnetic Chambers Live Cell Instrument Cat# CM-B18-1

    Purification:

    Article Title: Multimerization and Retention of the Scavenger Receptor SR-B1 in the Plasma Membrane.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies SR-B1, rabbit monoclonal Abcam Clone: EPI556Y; Cat# ab52629; RRID: AB_882458 b-Actin, mouse monoclonal Sigma-Aldrich Clone: AC-15; Cat# A1978; RRID: AB_476692 Clathrin heavy chain, mouse monoclonal Abcam Clone: X-22; Cat# ab2731; RRID: AB_303256 Caveolin-1, rabbit polyclonal BD Biosciences Cat# 610059; RRID: AB_397471 6His, mouse monoclonal Biolegend Clone: 6-His; Cat# 906101; RRID: AB_2565061 NHERF1, rabbit polyclonal Atlas Antibodies Cat# HPA027247; RRID: AB_10601162 NHERF2, rabbit polyclonal Atlas Antibodies Cat# HPA001672; RRID: AB_1080017 Ezrin, mouse monoclonal Thermo Fisher Clone: 3C12; Cat# MA5-13862; RRID: AB_10979020 Goat anti-rabbit IRDye 680RD LI-COR Cat# 925–68071; RRID: AB_2721181 Donkey anti-mouse IRDye 800CW LI-COR Cat# 925-32212; RRID: AB_2716622 CD81, hamster monoclonal Thermo Fisher Clone: Eat2; Cat# MA180209; RRID: AB_929499 Tfn-R, mouse monoclonal Thermo Fisher Clone: H68.4; Cat# 13-6800; RRID: AB_2533029 Chemicals, Peptides, and Recombinant Proteins Single-chain variable fragment (ScFv) This paper Based on mAb IgG C167 from Catanese et al., 2007 Human transferrin-AF488 Thermo Fisher Cat# T13342 Cholera Toxin B-AF488 Thermo Fisher Cat# C34775 FM 4–64 Thermo Fisher Cat# T13320 Anti GFP-binding protein (VHH, nanobody) Chromotek Cat# gt-250 Methyl-b-cyclodextrin (MbCD) Sigma-Aldrich Cat# C4555 2-bromopalmitate (2-BP) Sigma-Aldrich Cat# 238422 Latrunculin B Sigma-Aldrich Cat# L5288 Human HDL Kalen Biomedical Cat# 770300-4 Human LDL Kalen Biomedical Cat# 770200-4 Nile Red Thermo Fisher Cat# N3013 Ezrin Inhibitor Calbiochem Cat# NSC668394 Triton X-100 Fisher Scientific Cat# BP151-500 DAPI Thermo Fisher Cat# D1306 Hoechst 33258 Thermo Fisher Cat# H21491 Cy3B NHS ester GE Healthcare Cat# PA63101 DyLight 650 NHS ester Thermo Fisher Cat# 62265 Alexa Fluor 488 (AF488) NHS ester Thermo Fisher Cat# A20000 Top-Fluor Cholesterol Avanti Polar Lipids Cat# 810255 Nile Red Sigma-Aldrich Cat# N3013 Acti-Stain 670 Phalloidin Cytoskeleton Cat# PHDN1 ProLong Diamond Antifade mountant Thermo Fisher Cat# P36961 Oligomers ACGT Corporation N/A CloneAmp Hifi PCR premix Takara Cat# 638500 DpnI restriction enzyme New England Biolabs Cat# R0176S 2-mercaptoethanesulfonate (MESNA) Sigma-Aldrich Cat# 63705 Wheat germ agglutinin (WGA)-AF647 Thermo Fisher Cat# W32466 Critical Commercial Assays GeneJet RNA Purification Kit Thermo Fisher Cat# K0731 Superscript VILO cDNA synthesis Kit Thermo Fisher Cat# 11754-010 (Continued on next page) e1 Developmental Cell 50, 1–13.e1–e5, August 5, 2019 .. REAGENT or RESOURCE SOURCE IDENTIFIER Lipofectamine LTX with Plus Reagent Thermo Fisher Cat# 15338100 FuGENE 6 Transfection Reagent Promega Cat# E2691 VIROMER Blue Transfection Reagent Lipocalyx Cat# VB-01LB-00 Taqman Fast Advanced Master Mix Thermo Fisher Cat# 4444557 QIAquick PCR purification kit Qiagen Cat# 28104 In-Fusion HD EcoDry cloning kit Takara Cat# 639690 Pierce Cell Surface Protein Isolation kit Thermo Fisher Cat# 89881 Experimental Models: Cell Lines Human female NCI-H295R ATCC Cat# CRL-2128 Hamster female CHO-K1 ATCC Cat# CCL-61 Human male HepG2 ATCC Cat# HB-8065 Human HAMEC (sex not known) ScienCell Cat# 7200 Human male HDLEC PromoCell Cat# C-12216 Experimental Models: Organisms/Strains Escherichia coli Stellar Competent Cells Clontech Cat# 636763 Oligonucleotides TaqMan gene expression assay total SR-B1 Thermo Fisher Cat# Hs00969821_m1 Custom TaqMan gene expression assay SR-B1 canonical: Forward: actatgcccagtacgtcctcctg; Reverse: ctccaaaataaatagcatttctcttggctccgg Thermo Fisher N/A Custom TaqMan gene expression assay SR-B1.1: Forward: actatgcccagtacgtcctcctg; Reverse: gtcctcaggaccttggctccgga Thermo Fisher N/A TaqMan gene expression assay CD81 Thermo Fisher Cat# Hs01002167_m1 TaqMan gene expression assay CDKN1A Thermo Fisher Cat# Hs00355782_m1 SR-B1 Stealth siRNA Thermo Fisher Cat# HSS101570 CD81 Stealth siRNA Thermo Fisher Cat# HSS101629 Stealth RNAi negative control duplexes Thermo Fisher Cat# 12935300 Recombinant DNA SR-B1-GFP Neculai et al., 2013 N/A SR-B1.1-GFP This paper N/A SR-B1 Neculai et al., 2013 N/A SR-B1.1 This paper N/A GFP-TMC This paper N/A GFP-TMC.1 This paper N/A SR-B1 PALM-/- This paper N/A SR-B1 MYRI-/- This paper N/A SR-B1 L413A This paper N/A SR-B1 L413A/L427A This paper N/A SR-B1 L441A/L448A/L455A This paper N/A SR-B1 G15L/G18L/G25L This paper N/A VapB-mCherry Zewe et al., 2018 Addgene D4H-mCherry Maekawa and Fairn, 2015 N/A Clathrin light chain-GFP Gaidarov et al., 1999 N/A tdEos-SR-B1 This paper N/A Software and Algorithms Volocity Perkin Elmer http://cellularimaging.perkinelmer.com/downloads/ detail.php?id=14 GraphPad Prism GraphPad Software https://www.graphpad.com/scientific-software/ prism/ (Continued on next page) Developmental Cell 50, 1–13.e1–e5, August 5, 2019 e2 .. REAGENT or RESOURCE SOURCE IDENTIFIER MATLAB MathWorks https://www.mathworks.com/products/matlab.html u-Track single particle tracking software Jaqaman et al., 2011 https://www.utsouthwestern.edu/labs/danuser/ software/ Huygens Professional Scientific Volume Imaging https://svi.nl/Huygens-Professional Zen software Zeiss https://www.zeiss.com/microscopy/int/products/ microscope-software/zen-lite.html Other ITS+Premix Culture Supplement Corning Cat# 354352 ECM medium ScienCell Cat# 1001 ECGM-MV2 medium PromoCell Cat# C-22022 Antibiotic-Antimycotic Solution (100x) Multicell Cat# 450-115-EL Chamlide Magnetic Chambers Live Cell Instrument Cat# CM-B18-1

    Cloning:

    Article Title: Multimerization and Retention of the Scavenger Receptor SR-B1 in the Plasma Membrane.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies SR-B1, rabbit monoclonal Abcam Clone: EPI556Y; Cat# ab52629; RRID: AB_882458 b-Actin, mouse monoclonal Sigma-Aldrich Clone: AC-15; Cat# A1978; RRID: AB_476692 Clathrin heavy chain, mouse monoclonal Abcam Clone: X-22; Cat# ab2731; RRID: AB_303256 Caveolin-1, rabbit polyclonal BD Biosciences Cat# 610059; RRID: AB_397471 6His, mouse monoclonal Biolegend Clone: 6-His; Cat# 906101; RRID: AB_2565061 NHERF1, rabbit polyclonal Atlas Antibodies Cat# HPA027247; RRID: AB_10601162 NHERF2, rabbit polyclonal Atlas Antibodies Cat# HPA001672; RRID: AB_1080017 Ezrin, mouse monoclonal Thermo Fisher Clone: 3C12; Cat# MA5-13862; RRID: AB_10979020 Goat anti-rabbit IRDye 680RD LI-COR Cat# 925–68071; RRID: AB_2721181 Donkey anti-mouse IRDye 800CW LI-COR Cat# 925-32212; RRID: AB_2716622 CD81, hamster monoclonal Thermo Fisher Clone: Eat2; Cat# MA180209; RRID: AB_929499 Tfn-R, mouse monoclonal Thermo Fisher Clone: H68.4; Cat# 13-6800; RRID: AB_2533029 Chemicals, Peptides, and Recombinant Proteins Single-chain variable fragment (ScFv) This paper Based on mAb IgG C167 from Catanese et al., 2007 Human transferrin-AF488 Thermo Fisher Cat# T13342 Cholera Toxin B-AF488 Thermo Fisher Cat# C34775 FM 4–64 Thermo Fisher Cat# T13320 Anti GFP-binding protein (VHH, nanobody) Chromotek Cat# gt-250 Methyl-b-cyclodextrin (MbCD) Sigma-Aldrich Cat# C4555 2-bromopalmitate (2-BP) Sigma-Aldrich Cat# 238422 Latrunculin B Sigma-Aldrich Cat# L5288 Human HDL Kalen Biomedical Cat# 770300-4 Human LDL Kalen Biomedical Cat# 770200-4 Nile Red Thermo Fisher Cat# N3013 Ezrin Inhibitor Calbiochem Cat# NSC668394 Triton X-100 Fisher Scientific Cat# BP151-500 DAPI Thermo Fisher Cat# D1306 Hoechst 33258 Thermo Fisher Cat# H21491 Cy3B NHS ester GE Healthcare Cat# PA63101 DyLight 650 NHS ester Thermo Fisher Cat# 62265 Alexa Fluor 488 (AF488) NHS ester Thermo Fisher Cat# A20000 Top-Fluor Cholesterol Avanti Polar Lipids Cat# 810255 Nile Red Sigma-Aldrich Cat# N3013 Acti-Stain 670 Phalloidin Cytoskeleton Cat# PHDN1 ProLong Diamond Antifade mountant Thermo Fisher Cat# P36961 Oligomers ACGT Corporation N/A CloneAmp Hifi PCR premix Takara Cat# 638500 DpnI restriction enzyme New England Biolabs Cat# R0176S 2-mercaptoethanesulfonate (MESNA) Sigma-Aldrich Cat# 63705 Wheat germ agglutinin (WGA)-AF647 Thermo Fisher Cat# W32466 Critical Commercial Assays GeneJet RNA Purification Kit Thermo Fisher Cat# K0731 Superscript VILO cDNA synthesis Kit Thermo Fisher Cat# 11754-010 (Continued on next page) e1 Developmental Cell 50, 1–13.e1–e5, August 5, 2019 .. REAGENT or RESOURCE SOURCE IDENTIFIER Lipofectamine LTX with Plus Reagent Thermo Fisher Cat# 15338100 FuGENE 6 Transfection Reagent Promega Cat# E2691 VIROMER Blue Transfection Reagent Lipocalyx Cat# VB-01LB-00 Taqman Fast Advanced Master Mix Thermo Fisher Cat# 4444557 QIAquick PCR purification kit Qiagen Cat# 28104 In-Fusion HD EcoDry cloning kit Takara Cat# 639690 Pierce Cell Surface Protein Isolation kit Thermo Fisher Cat# 89881 Experimental Models: Cell Lines Human female NCI-H295R ATCC Cat# CRL-2128 Hamster female CHO-K1 ATCC Cat# CCL-61 Human male HepG2 ATCC Cat# HB-8065 Human HAMEC (sex not known) ScienCell Cat# 7200 Human male HDLEC PromoCell Cat# C-12216 Experimental Models: Organisms/Strains Escherichia coli Stellar Competent Cells Clontech Cat# 636763 Oligonucleotides TaqMan gene expression assay total SR-B1 Thermo Fisher Cat# Hs00969821_m1 Custom TaqMan gene expression assay SR-B1 canonical: Forward: actatgcccagtacgtcctcctg; Reverse: ctccaaaataaatagcatttctcttggctccgg Thermo Fisher N/A Custom TaqMan gene expression assay SR-B1.1: Forward: actatgcccagtacgtcctcctg; Reverse: gtcctcaggaccttggctccgga Thermo Fisher N/A TaqMan gene expression assay CD81 Thermo Fisher Cat# Hs01002167_m1 TaqMan gene expression assay CDKN1A Thermo Fisher Cat# Hs00355782_m1 SR-B1 Stealth siRNA Thermo Fisher Cat# HSS101570 CD81 Stealth siRNA Thermo Fisher Cat# HSS101629 Stealth RNAi negative control duplexes Thermo Fisher Cat# 12935300 Recombinant DNA SR-B1-GFP Neculai et al., 2013 N/A SR-B1.1-GFP This paper N/A SR-B1 Neculai et al., 2013 N/A SR-B1.1 This paper N/A GFP-TMC This paper N/A GFP-TMC.1 This paper N/A SR-B1 PALM-/- This paper N/A SR-B1 MYRI-/- This paper N/A SR-B1 L413A This paper N/A SR-B1 L413A/L427A This paper N/A SR-B1 L441A/L448A/L455A This paper N/A SR-B1 G15L/G18L/G25L This paper N/A VapB-mCherry Zewe et al., 2018 Addgene D4H-mCherry Maekawa and Fairn, 2015 N/A Clathrin light chain-GFP Gaidarov et al., 1999 N/A tdEos-SR-B1 This paper N/A Software and Algorithms Volocity Perkin Elmer http://cellularimaging.perkinelmer.com/downloads/ detail.php?id=14 GraphPad Prism GraphPad Software https://www.graphpad.com/scientific-software/ prism/ (Continued on next page) Developmental Cell 50, 1–13.e1–e5, August 5, 2019 e2 .. REAGENT or RESOURCE SOURCE IDENTIFIER MATLAB MathWorks https://www.mathworks.com/products/matlab.html u-Track single particle tracking software Jaqaman et al., 2011 https://www.utsouthwestern.edu/labs/danuser/ software/ Huygens Professional Scientific Volume Imaging https://svi.nl/Huygens-Professional Zen software Zeiss https://www.zeiss.com/microscopy/int/products/ microscope-software/zen-lite.html Other ITS+Premix Culture Supplement Corning Cat# 354352 ECM medium ScienCell Cat# 1001 ECGM-MV2 medium PromoCell Cat# C-22022 Antibiotic-Antimycotic Solution (100x) Multicell Cat# 450-115-EL Chamlide Magnetic Chambers Live Cell Instrument Cat# CM-B18-1

    Isolation:

    Article Title: Multimerization and Retention of the Scavenger Receptor SR-B1 in the Plasma Membrane.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies SR-B1, rabbit monoclonal Abcam Clone: EPI556Y; Cat# ab52629; RRID: AB_882458 b-Actin, mouse monoclonal Sigma-Aldrich Clone: AC-15; Cat# A1978; RRID: AB_476692 Clathrin heavy chain, mouse monoclonal Abcam Clone: X-22; Cat# ab2731; RRID: AB_303256 Caveolin-1, rabbit polyclonal BD Biosciences Cat# 610059; RRID: AB_397471 6His, mouse monoclonal Biolegend Clone: 6-His; Cat# 906101; RRID: AB_2565061 NHERF1, rabbit polyclonal Atlas Antibodies Cat# HPA027247; RRID: AB_10601162 NHERF2, rabbit polyclonal Atlas Antibodies Cat# HPA001672; RRID: AB_1080017 Ezrin, mouse monoclonal Thermo Fisher Clone: 3C12; Cat# MA5-13862; RRID: AB_10979020 Goat anti-rabbit IRDye 680RD LI-COR Cat# 925–68071; RRID: AB_2721181 Donkey anti-mouse IRDye 800CW LI-COR Cat# 925-32212; RRID: AB_2716622 CD81, hamster monoclonal Thermo Fisher Clone: Eat2; Cat# MA180209; RRID: AB_929499 Tfn-R, mouse monoclonal Thermo Fisher Clone: H68.4; Cat# 13-6800; RRID: AB_2533029 Chemicals, Peptides, and Recombinant Proteins Single-chain variable fragment (ScFv) This paper Based on mAb IgG C167 from Catanese et al., 2007 Human transferrin-AF488 Thermo Fisher Cat# T13342 Cholera Toxin B-AF488 Thermo Fisher Cat# C34775 FM 4–64 Thermo Fisher Cat# T13320 Anti GFP-binding protein (VHH, nanobody) Chromotek Cat# gt-250 Methyl-b-cyclodextrin (MbCD) Sigma-Aldrich Cat# C4555 2-bromopalmitate (2-BP) Sigma-Aldrich Cat# 238422 Latrunculin B Sigma-Aldrich Cat# L5288 Human HDL Kalen Biomedical Cat# 770300-4 Human LDL Kalen Biomedical Cat# 770200-4 Nile Red Thermo Fisher Cat# N3013 Ezrin Inhibitor Calbiochem Cat# NSC668394 Triton X-100 Fisher Scientific Cat# BP151-500 DAPI Thermo Fisher Cat# D1306 Hoechst 33258 Thermo Fisher Cat# H21491 Cy3B NHS ester GE Healthcare Cat# PA63101 DyLight 650 NHS ester Thermo Fisher Cat# 62265 Alexa Fluor 488 (AF488) NHS ester Thermo Fisher Cat# A20000 Top-Fluor Cholesterol Avanti Polar Lipids Cat# 810255 Nile Red Sigma-Aldrich Cat# N3013 Acti-Stain 670 Phalloidin Cytoskeleton Cat# PHDN1 ProLong Diamond Antifade mountant Thermo Fisher Cat# P36961 Oligomers ACGT Corporation N/A CloneAmp Hifi PCR premix Takara Cat# 638500 DpnI restriction enzyme New England Biolabs Cat# R0176S 2-mercaptoethanesulfonate (MESNA) Sigma-Aldrich Cat# 63705 Wheat germ agglutinin (WGA)-AF647 Thermo Fisher Cat# W32466 Critical Commercial Assays GeneJet RNA Purification Kit Thermo Fisher Cat# K0731 Superscript VILO cDNA synthesis Kit Thermo Fisher Cat# 11754-010 (Continued on next page) e1 Developmental Cell 50, 1–13.e1–e5, August 5, 2019 .. REAGENT or RESOURCE SOURCE IDENTIFIER Lipofectamine LTX with Plus Reagent Thermo Fisher Cat# 15338100 FuGENE 6 Transfection Reagent Promega Cat# E2691 VIROMER Blue Transfection Reagent Lipocalyx Cat# VB-01LB-00 Taqman Fast Advanced Master Mix Thermo Fisher Cat# 4444557 QIAquick PCR purification kit Qiagen Cat# 28104 In-Fusion HD EcoDry cloning kit Takara Cat# 639690 Pierce Cell Surface Protein Isolation kit Thermo Fisher Cat# 89881 Experimental Models: Cell Lines Human female NCI-H295R ATCC Cat# CRL-2128 Hamster female CHO-K1 ATCC Cat# CCL-61 Human male HepG2 ATCC Cat# HB-8065 Human HAMEC (sex not known) ScienCell Cat# 7200 Human male HDLEC PromoCell Cat# C-12216 Experimental Models: Organisms/Strains Escherichia coli Stellar Competent Cells Clontech Cat# 636763 Oligonucleotides TaqMan gene expression assay total SR-B1 Thermo Fisher Cat# Hs00969821_m1 Custom TaqMan gene expression assay SR-B1 canonical: Forward: actatgcccagtacgtcctcctg; Reverse: ctccaaaataaatagcatttctcttggctccgg Thermo Fisher N/A Custom TaqMan gene expression assay SR-B1.1: Forward: actatgcccagtacgtcctcctg; Reverse: gtcctcaggaccttggctccgga Thermo Fisher N/A TaqMan gene expression assay CD81 Thermo Fisher Cat# Hs01002167_m1 TaqMan gene expression assay CDKN1A Thermo Fisher Cat# Hs00355782_m1 SR-B1 Stealth siRNA Thermo Fisher Cat# HSS101570 CD81 Stealth siRNA Thermo Fisher Cat# HSS101629 Stealth RNAi negative control duplexes Thermo Fisher Cat# 12935300 Recombinant DNA SR-B1-GFP Neculai et al., 2013 N/A SR-B1.1-GFP This paper N/A SR-B1 Neculai et al., 2013 N/A SR-B1.1 This paper N/A GFP-TMC This paper N/A GFP-TMC.1 This paper N/A SR-B1 PALM-/- This paper N/A SR-B1 MYRI-/- This paper N/A SR-B1 L413A This paper N/A SR-B1 L413A/L427A This paper N/A SR-B1 L441A/L448A/L455A This paper N/A SR-B1 G15L/G18L/G25L This paper N/A VapB-mCherry Zewe et al., 2018 Addgene D4H-mCherry Maekawa and Fairn, 2015 N/A Clathrin light chain-GFP Gaidarov et al., 1999 N/A tdEos-SR-B1 This paper N/A Software and Algorithms Volocity Perkin Elmer http://cellularimaging.perkinelmer.com/downloads/ detail.php?id=14 GraphPad Prism GraphPad Software https://www.graphpad.com/scientific-software/ prism/ (Continued on next page) Developmental Cell 50, 1–13.e1–e5, August 5, 2019 e2 .. REAGENT or RESOURCE SOURCE IDENTIFIER MATLAB MathWorks https://www.mathworks.com/products/matlab.html u-Track single particle tracking software Jaqaman et al., 2011 https://www.utsouthwestern.edu/labs/danuser/ software/ Huygens Professional Scientific Volume Imaging https://svi.nl/Huygens-Professional Zen software Zeiss https://www.zeiss.com/microscopy/int/products/ microscope-software/zen-lite.html Other ITS+Premix Culture Supplement Corning Cat# 354352 ECM medium ScienCell Cat# 1001 ECGM-MV2 medium PromoCell Cat# C-22022 Antibiotic-Antimycotic Solution (100x) Multicell Cat# 450-115-EL Chamlide Magnetic Chambers Live Cell Instrument Cat# CM-B18-1

    Gene Expression:

    Article Title: Multimerization and Retention of the Scavenger Receptor SR-B1 in the Plasma Membrane.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies SR-B1, rabbit monoclonal Abcam Clone: EPI556Y; Cat# ab52629; RRID: AB_882458 b-Actin, mouse monoclonal Sigma-Aldrich Clone: AC-15; Cat# A1978; RRID: AB_476692 Clathrin heavy chain, mouse monoclonal Abcam Clone: X-22; Cat# ab2731; RRID: AB_303256 Caveolin-1, rabbit polyclonal BD Biosciences Cat# 610059; RRID: AB_397471 6His, mouse monoclonal Biolegend Clone: 6-His; Cat# 906101; RRID: AB_2565061 NHERF1, rabbit polyclonal Atlas Antibodies Cat# HPA027247; RRID: AB_10601162 NHERF2, rabbit polyclonal Atlas Antibodies Cat# HPA001672; RRID: AB_1080017 Ezrin, mouse monoclonal Thermo Fisher Clone: 3C12; Cat# MA5-13862; RRID: AB_10979020 Goat anti-rabbit IRDye 680RD LI-COR Cat# 925–68071; RRID: AB_2721181 Donkey anti-mouse IRDye 800CW LI-COR Cat# 925-32212; RRID: AB_2716622 CD81, hamster monoclonal Thermo Fisher Clone: Eat2; Cat# MA180209; RRID: AB_929499 Tfn-R, mouse monoclonal Thermo Fisher Clone: H68.4; Cat# 13-6800; RRID: AB_2533029 Chemicals, Peptides, and Recombinant Proteins Single-chain variable fragment (ScFv) This paper Based on mAb IgG C167 from Catanese et al., 2007 Human transferrin-AF488 Thermo Fisher Cat# T13342 Cholera Toxin B-AF488 Thermo Fisher Cat# C34775 FM 4–64 Thermo Fisher Cat# T13320 Anti GFP-binding protein (VHH, nanobody) Chromotek Cat# gt-250 Methyl-b-cyclodextrin (MbCD) Sigma-Aldrich Cat# C4555 2-bromopalmitate (2-BP) Sigma-Aldrich Cat# 238422 Latrunculin B Sigma-Aldrich Cat# L5288 Human HDL Kalen Biomedical Cat# 770300-4 Human LDL Kalen Biomedical Cat# 770200-4 Nile Red Thermo Fisher Cat# N3013 Ezrin Inhibitor Calbiochem Cat# NSC668394 Triton X-100 Fisher Scientific Cat# BP151-500 DAPI Thermo Fisher Cat# D1306 Hoechst 33258 Thermo Fisher Cat# H21491 Cy3B NHS ester GE Healthcare Cat# PA63101 DyLight 650 NHS ester Thermo Fisher Cat# 62265 Alexa Fluor 488 (AF488) NHS ester Thermo Fisher Cat# A20000 Top-Fluor Cholesterol Avanti Polar Lipids Cat# 810255 Nile Red Sigma-Aldrich Cat# N3013 Acti-Stain 670 Phalloidin Cytoskeleton Cat# PHDN1 ProLong Diamond Antifade mountant Thermo Fisher Cat# P36961 Oligomers ACGT Corporation N/A CloneAmp Hifi PCR premix Takara Cat# 638500 DpnI restriction enzyme New England Biolabs Cat# R0176S 2-mercaptoethanesulfonate (MESNA) Sigma-Aldrich Cat# 63705 Wheat germ agglutinin (WGA)-AF647 Thermo Fisher Cat# W32466 Critical Commercial Assays GeneJet RNA Purification Kit Thermo Fisher Cat# K0731 Superscript VILO cDNA synthesis Kit Thermo Fisher Cat# 11754-010 (Continued on next page) e1 Developmental Cell 50, 1–13.e1–e5, August 5, 2019 .. REAGENT or RESOURCE SOURCE IDENTIFIER Lipofectamine LTX with Plus Reagent Thermo Fisher Cat# 15338100 FuGENE 6 Transfection Reagent Promega Cat# E2691 VIROMER Blue Transfection Reagent Lipocalyx Cat# VB-01LB-00 Taqman Fast Advanced Master Mix Thermo Fisher Cat# 4444557 QIAquick PCR purification kit Qiagen Cat# 28104 In-Fusion HD EcoDry cloning kit Takara Cat# 639690 Pierce Cell Surface Protein Isolation kit Thermo Fisher Cat# 89881 Experimental Models: Cell Lines Human female NCI-H295R ATCC Cat# CRL-2128 Hamster female CHO-K1 ATCC Cat# CCL-61 Human male HepG2 ATCC Cat# HB-8065 Human HAMEC (sex not known) ScienCell Cat# 7200 Human male HDLEC PromoCell Cat# C-12216 Experimental Models: Organisms/Strains Escherichia coli Stellar Competent Cells Clontech Cat# 636763 Oligonucleotides TaqMan gene expression assay total SR-B1 Thermo Fisher Cat# Hs00969821_m1 Custom TaqMan gene expression assay SR-B1 canonical: Forward: actatgcccagtacgtcctcctg; Reverse: ctccaaaataaatagcatttctcttggctccgg Thermo Fisher N/A Custom TaqMan gene expression assay SR-B1.1: Forward: actatgcccagtacgtcctcctg; Reverse: gtcctcaggaccttggctccgga Thermo Fisher N/A TaqMan gene expression assay CD81 Thermo Fisher Cat# Hs01002167_m1 TaqMan gene expression assay CDKN1A Thermo Fisher Cat# Hs00355782_m1 SR-B1 Stealth siRNA Thermo Fisher Cat# HSS101570 CD81 Stealth siRNA Thermo Fisher Cat# HSS101629 Stealth RNAi negative control duplexes Thermo Fisher Cat# 12935300 Recombinant DNA SR-B1-GFP Neculai et al., 2013 N/A SR-B1.1-GFP This paper N/A SR-B1 Neculai et al., 2013 N/A SR-B1.1 This paper N/A GFP-TMC This paper N/A GFP-TMC.1 This paper N/A SR-B1 PALM-/- This paper N/A SR-B1 MYRI-/- This paper N/A SR-B1 L413A This paper N/A SR-B1 L413A/L427A This paper N/A SR-B1 L441A/L448A/L455A This paper N/A SR-B1 G15L/G18L/G25L This paper N/A VapB-mCherry Zewe et al., 2018 Addgene D4H-mCherry Maekawa and Fairn, 2015 N/A Clathrin light chain-GFP Gaidarov et al., 1999 N/A tdEos-SR-B1 This paper N/A Software and Algorithms Volocity Perkin Elmer http://cellularimaging.perkinelmer.com/downloads/ detail.php?id=14 GraphPad Prism GraphPad Software https://www.graphpad.com/scientific-software/ prism/ (Continued on next page) Developmental Cell 50, 1–13.e1–e5, August 5, 2019 e2 .. REAGENT or RESOURCE SOURCE IDENTIFIER MATLAB MathWorks https://www.mathworks.com/products/matlab.html u-Track single particle tracking software Jaqaman et al., 2011 https://www.utsouthwestern.edu/labs/danuser/ software/ Huygens Professional Scientific Volume Imaging https://svi.nl/Huygens-Professional Zen software Zeiss https://www.zeiss.com/microscopy/int/products/ microscope-software/zen-lite.html Other ITS+Premix Culture Supplement Corning Cat# 354352 ECM medium ScienCell Cat# 1001 ECGM-MV2 medium PromoCell Cat# C-22022 Antibiotic-Antimycotic Solution (100x) Multicell Cat# 450-115-EL Chamlide Magnetic Chambers Live Cell Instrument Cat# CM-B18-1

    Negative Control:

    Article Title: Multimerization and Retention of the Scavenger Receptor SR-B1 in the Plasma Membrane.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies SR-B1, rabbit monoclonal Abcam Clone: EPI556Y; Cat# ab52629; RRID: AB_882458 b-Actin, mouse monoclonal Sigma-Aldrich Clone: AC-15; Cat# A1978; RRID: AB_476692 Clathrin heavy chain, mouse monoclonal Abcam Clone: X-22; Cat# ab2731; RRID: AB_303256 Caveolin-1, rabbit polyclonal BD Biosciences Cat# 610059; RRID: AB_397471 6His, mouse monoclonal Biolegend Clone: 6-His; Cat# 906101; RRID: AB_2565061 NHERF1, rabbit polyclonal Atlas Antibodies Cat# HPA027247; RRID: AB_10601162 NHERF2, rabbit polyclonal Atlas Antibodies Cat# HPA001672; RRID: AB_1080017 Ezrin, mouse monoclonal Thermo Fisher Clone: 3C12; Cat# MA5-13862; RRID: AB_10979020 Goat anti-rabbit IRDye 680RD LI-COR Cat# 925–68071; RRID: AB_2721181 Donkey anti-mouse IRDye 800CW LI-COR Cat# 925-32212; RRID: AB_2716622 CD81, hamster monoclonal Thermo Fisher Clone: Eat2; Cat# MA180209; RRID: AB_929499 Tfn-R, mouse monoclonal Thermo Fisher Clone: H68.4; Cat# 13-6800; RRID: AB_2533029 Chemicals, Peptides, and Recombinant Proteins Single-chain variable fragment (ScFv) This paper Based on mAb IgG C167 from Catanese et al., 2007 Human transferrin-AF488 Thermo Fisher Cat# T13342 Cholera Toxin B-AF488 Thermo Fisher Cat# C34775 FM 4–64 Thermo Fisher Cat# T13320 Anti GFP-binding protein (VHH, nanobody) Chromotek Cat# gt-250 Methyl-b-cyclodextrin (MbCD) Sigma-Aldrich Cat# C4555 2-bromopalmitate (2-BP) Sigma-Aldrich Cat# 238422 Latrunculin B Sigma-Aldrich Cat# L5288 Human HDL Kalen Biomedical Cat# 770300-4 Human LDL Kalen Biomedical Cat# 770200-4 Nile Red Thermo Fisher Cat# N3013 Ezrin Inhibitor Calbiochem Cat# NSC668394 Triton X-100 Fisher Scientific Cat# BP151-500 DAPI Thermo Fisher Cat# D1306 Hoechst 33258 Thermo Fisher Cat# H21491 Cy3B NHS ester GE Healthcare Cat# PA63101 DyLight 650 NHS ester Thermo Fisher Cat# 62265 Alexa Fluor 488 (AF488) NHS ester Thermo Fisher Cat# A20000 Top-Fluor Cholesterol Avanti Polar Lipids Cat# 810255 Nile Red Sigma-Aldrich Cat# N3013 Acti-Stain 670 Phalloidin Cytoskeleton Cat# PHDN1 ProLong Diamond Antifade mountant Thermo Fisher Cat# P36961 Oligomers ACGT Corporation N/A CloneAmp Hifi PCR premix Takara Cat# 638500 DpnI restriction enzyme New England Biolabs Cat# R0176S 2-mercaptoethanesulfonate (MESNA) Sigma-Aldrich Cat# 63705 Wheat germ agglutinin (WGA)-AF647 Thermo Fisher Cat# W32466 Critical Commercial Assays GeneJet RNA Purification Kit Thermo Fisher Cat# K0731 Superscript VILO cDNA synthesis Kit Thermo Fisher Cat# 11754-010 (Continued on next page) e1 Developmental Cell 50, 1–13.e1–e5, August 5, 2019 .. REAGENT or RESOURCE SOURCE IDENTIFIER Lipofectamine LTX with Plus Reagent Thermo Fisher Cat# 15338100 FuGENE 6 Transfection Reagent Promega Cat# E2691 VIROMER Blue Transfection Reagent Lipocalyx Cat# VB-01LB-00 Taqman Fast Advanced Master Mix Thermo Fisher Cat# 4444557 QIAquick PCR purification kit Qiagen Cat# 28104 In-Fusion HD EcoDry cloning kit Takara Cat# 639690 Pierce Cell Surface Protein Isolation kit Thermo Fisher Cat# 89881 Experimental Models: Cell Lines Human female NCI-H295R ATCC Cat# CRL-2128 Hamster female CHO-K1 ATCC Cat# CCL-61 Human male HepG2 ATCC Cat# HB-8065 Human HAMEC (sex not known) ScienCell Cat# 7200 Human male HDLEC PromoCell Cat# C-12216 Experimental Models: Organisms/Strains Escherichia coli Stellar Competent Cells Clontech Cat# 636763 Oligonucleotides TaqMan gene expression assay total SR-B1 Thermo Fisher Cat# Hs00969821_m1 Custom TaqMan gene expression assay SR-B1 canonical: Forward: actatgcccagtacgtcctcctg; Reverse: ctccaaaataaatagcatttctcttggctccgg Thermo Fisher N/A Custom TaqMan gene expression assay SR-B1.1: Forward: actatgcccagtacgtcctcctg; Reverse: gtcctcaggaccttggctccgga Thermo Fisher N/A TaqMan gene expression assay CD81 Thermo Fisher Cat# Hs01002167_m1 TaqMan gene expression assay CDKN1A Thermo Fisher Cat# Hs00355782_m1 SR-B1 Stealth siRNA Thermo Fisher Cat# HSS101570 CD81 Stealth siRNA Thermo Fisher Cat# HSS101629 Stealth RNAi negative control duplexes Thermo Fisher Cat# 12935300 Recombinant DNA SR-B1-GFP Neculai et al., 2013 N/A SR-B1.1-GFP This paper N/A SR-B1 Neculai et al., 2013 N/A SR-B1.1 This paper N/A GFP-TMC This paper N/A GFP-TMC.1 This paper N/A SR-B1 PALM-/- This paper N/A SR-B1 MYRI-/- This paper N/A SR-B1 L413A This paper N/A SR-B1 L413A/L427A This paper N/A SR-B1 L441A/L448A/L455A This paper N/A SR-B1 G15L/G18L/G25L This paper N/A VapB-mCherry Zewe et al., 2018 Addgene D4H-mCherry Maekawa and Fairn, 2015 N/A Clathrin light chain-GFP Gaidarov et al., 1999 N/A tdEos-SR-B1 This paper N/A Software and Algorithms Volocity Perkin Elmer http://cellularimaging.perkinelmer.com/downloads/ detail.php?id=14 GraphPad Prism GraphPad Software https://www.graphpad.com/scientific-software/ prism/ (Continued on next page) Developmental Cell 50, 1–13.e1–e5, August 5, 2019 e2 .. REAGENT or RESOURCE SOURCE IDENTIFIER MATLAB MathWorks https://www.mathworks.com/products/matlab.html u-Track single particle tracking software Jaqaman et al., 2011 https://www.utsouthwestern.edu/labs/danuser/ software/ Huygens Professional Scientific Volume Imaging https://svi.nl/Huygens-Professional Zen software Zeiss https://www.zeiss.com/microscopy/int/products/ microscope-software/zen-lite.html Other ITS+Premix Culture Supplement Corning Cat# 354352 ECM medium ScienCell Cat# 1001 ECGM-MV2 medium PromoCell Cat# C-22022 Antibiotic-Antimycotic Solution (100x) Multicell Cat# 450-115-EL Chamlide Magnetic Chambers Live Cell Instrument Cat# CM-B18-1

    Recombinant:

    Article Title: Multimerization and Retention of the Scavenger Receptor SR-B1 in the Plasma Membrane.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies SR-B1, rabbit monoclonal Abcam Clone: EPI556Y; Cat# ab52629; RRID: AB_882458 b-Actin, mouse monoclonal Sigma-Aldrich Clone: AC-15; Cat# A1978; RRID: AB_476692 Clathrin heavy chain, mouse monoclonal Abcam Clone: X-22; Cat# ab2731; RRID: AB_303256 Caveolin-1, rabbit polyclonal BD Biosciences Cat# 610059; RRID: AB_397471 6His, mouse monoclonal Biolegend Clone: 6-His; Cat# 906101; RRID: AB_2565061 NHERF1, rabbit polyclonal Atlas Antibodies Cat# HPA027247; RRID: AB_10601162 NHERF2, rabbit polyclonal Atlas Antibodies Cat# HPA001672; RRID: AB_1080017 Ezrin, mouse monoclonal Thermo Fisher Clone: 3C12; Cat# MA5-13862; RRID: AB_10979020 Goat anti-rabbit IRDye 680RD LI-COR Cat# 925–68071; RRID: AB_2721181 Donkey anti-mouse IRDye 800CW LI-COR Cat# 925-32212; RRID: AB_2716622 CD81, hamster monoclonal Thermo Fisher Clone: Eat2; Cat# MA180209; RRID: AB_929499 Tfn-R, mouse monoclonal Thermo Fisher Clone: H68.4; Cat# 13-6800; RRID: AB_2533029 Chemicals, Peptides, and Recombinant Proteins Single-chain variable fragment (ScFv) This paper Based on mAb IgG C167 from Catanese et al., 2007 Human transferrin-AF488 Thermo Fisher Cat# T13342 Cholera Toxin B-AF488 Thermo Fisher Cat# C34775 FM 4–64 Thermo Fisher Cat# T13320 Anti GFP-binding protein (VHH, nanobody) Chromotek Cat# gt-250 Methyl-b-cyclodextrin (MbCD) Sigma-Aldrich Cat# C4555 2-bromopalmitate (2-BP) Sigma-Aldrich Cat# 238422 Latrunculin B Sigma-Aldrich Cat# L5288 Human HDL Kalen Biomedical Cat# 770300-4 Human LDL Kalen Biomedical Cat# 770200-4 Nile Red Thermo Fisher Cat# N3013 Ezrin Inhibitor Calbiochem Cat# NSC668394 Triton X-100 Fisher Scientific Cat# BP151-500 DAPI Thermo Fisher Cat# D1306 Hoechst 33258 Thermo Fisher Cat# H21491 Cy3B NHS ester GE Healthcare Cat# PA63101 DyLight 650 NHS ester Thermo Fisher Cat# 62265 Alexa Fluor 488 (AF488) NHS ester Thermo Fisher Cat# A20000 Top-Fluor Cholesterol Avanti Polar Lipids Cat# 810255 Nile Red Sigma-Aldrich Cat# N3013 Acti-Stain 670 Phalloidin Cytoskeleton Cat# PHDN1 ProLong Diamond Antifade mountant Thermo Fisher Cat# P36961 Oligomers ACGT Corporation N/A CloneAmp Hifi PCR premix Takara Cat# 638500 DpnI restriction enzyme New England Biolabs Cat# R0176S 2-mercaptoethanesulfonate (MESNA) Sigma-Aldrich Cat# 63705 Wheat germ agglutinin (WGA)-AF647 Thermo Fisher Cat# W32466 Critical Commercial Assays GeneJet RNA Purification Kit Thermo Fisher Cat# K0731 Superscript VILO cDNA synthesis Kit Thermo Fisher Cat# 11754-010 (Continued on next page) e1 Developmental Cell 50, 1–13.e1–e5, August 5, 2019 .. REAGENT or RESOURCE SOURCE IDENTIFIER Lipofectamine LTX with Plus Reagent Thermo Fisher Cat# 15338100 FuGENE 6 Transfection Reagent Promega Cat# E2691 VIROMER Blue Transfection Reagent Lipocalyx Cat# VB-01LB-00 Taqman Fast Advanced Master Mix Thermo Fisher Cat# 4444557 QIAquick PCR purification kit Qiagen Cat# 28104 In-Fusion HD EcoDry cloning kit Takara Cat# 639690 Pierce Cell Surface Protein Isolation kit Thermo Fisher Cat# 89881 Experimental Models: Cell Lines Human female NCI-H295R ATCC Cat# CRL-2128 Hamster female CHO-K1 ATCC Cat# CCL-61 Human male HepG2 ATCC Cat# HB-8065 Human HAMEC (sex not known) ScienCell Cat# 7200 Human male HDLEC PromoCell Cat# C-12216 Experimental Models: Organisms/Strains Escherichia coli Stellar Competent Cells Clontech Cat# 636763 Oligonucleotides TaqMan gene expression assay total SR-B1 Thermo Fisher Cat# Hs00969821_m1 Custom TaqMan gene expression assay SR-B1 canonical: Forward: actatgcccagtacgtcctcctg; Reverse: ctccaaaataaatagcatttctcttggctccgg Thermo Fisher N/A Custom TaqMan gene expression assay SR-B1.1: Forward: actatgcccagtacgtcctcctg; Reverse: gtcctcaggaccttggctccgga Thermo Fisher N/A TaqMan gene expression assay CD81 Thermo Fisher Cat# Hs01002167_m1 TaqMan gene expression assay CDKN1A Thermo Fisher Cat# Hs00355782_m1 SR-B1 Stealth siRNA Thermo Fisher Cat# HSS101570 CD81 Stealth siRNA Thermo Fisher Cat# HSS101629 Stealth RNAi negative control duplexes Thermo Fisher Cat# 12935300 Recombinant DNA SR-B1-GFP Neculai et al., 2013 N/A SR-B1.1-GFP This paper N/A SR-B1 Neculai et al., 2013 N/A SR-B1.1 This paper N/A GFP-TMC This paper N/A GFP-TMC.1 This paper N/A SR-B1 PALM-/- This paper N/A SR-B1 MYRI-/- This paper N/A SR-B1 L413A This paper N/A SR-B1 L413A/L427A This paper N/A SR-B1 L441A/L448A/L455A This paper N/A SR-B1 G15L/G18L/G25L This paper N/A VapB-mCherry Zewe et al., 2018 Addgene D4H-mCherry Maekawa and Fairn, 2015 N/A Clathrin light chain-GFP Gaidarov et al., 1999 N/A tdEos-SR-B1 This paper N/A Software and Algorithms Volocity Perkin Elmer http://cellularimaging.perkinelmer.com/downloads/ detail.php?id=14 GraphPad Prism GraphPad Software https://www.graphpad.com/scientific-software/ prism/ (Continued on next page) Developmental Cell 50, 1–13.e1–e5, August 5, 2019 e2 .. REAGENT or RESOURCE SOURCE IDENTIFIER MATLAB MathWorks https://www.mathworks.com/products/matlab.html u-Track single particle tracking software Jaqaman et al., 2011 https://www.utsouthwestern.edu/labs/danuser/ software/ Huygens Professional Scientific Volume Imaging https://svi.nl/Huygens-Professional Zen software Zeiss https://www.zeiss.com/microscopy/int/products/ microscope-software/zen-lite.html Other ITS+Premix Culture Supplement Corning Cat# 354352 ECM medium ScienCell Cat# 1001 ECGM-MV2 medium PromoCell Cat# C-22022 Antibiotic-Antimycotic Solution (100x) Multicell Cat# 450-115-EL Chamlide Magnetic Chambers Live Cell Instrument Cat# CM-B18-1

    Software:

    Article Title: Multimerization and Retention of the Scavenger Receptor SR-B1 in the Plasma Membrane.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies SR-B1, rabbit monoclonal Abcam Clone: EPI556Y; Cat# ab52629; RRID: AB_882458 b-Actin, mouse monoclonal Sigma-Aldrich Clone: AC-15; Cat# A1978; RRID: AB_476692 Clathrin heavy chain, mouse monoclonal Abcam Clone: X-22; Cat# ab2731; RRID: AB_303256 Caveolin-1, rabbit polyclonal BD Biosciences Cat# 610059; RRID: AB_397471 6His, mouse monoclonal Biolegend Clone: 6-His; Cat# 906101; RRID: AB_2565061 NHERF1, rabbit polyclonal Atlas Antibodies Cat# HPA027247; RRID: AB_10601162 NHERF2, rabbit polyclonal Atlas Antibodies Cat# HPA001672; RRID: AB_1080017 Ezrin, mouse monoclonal Thermo Fisher Clone: 3C12; Cat# MA5-13862; RRID: AB_10979020 Goat anti-rabbit IRDye 680RD LI-COR Cat# 925–68071; RRID: AB_2721181 Donkey anti-mouse IRDye 800CW LI-COR Cat# 925-32212; RRID: AB_2716622 CD81, hamster monoclonal Thermo Fisher Clone: Eat2; Cat# MA180209; RRID: AB_929499 Tfn-R, mouse monoclonal Thermo Fisher Clone: H68.4; Cat# 13-6800; RRID: AB_2533029 Chemicals, Peptides, and Recombinant Proteins Single-chain variable fragment (ScFv) This paper Based on mAb IgG C167 from Catanese et al., 2007 Human transferrin-AF488 Thermo Fisher Cat# T13342 Cholera Toxin B-AF488 Thermo Fisher Cat# C34775 FM 4–64 Thermo Fisher Cat# T13320 Anti GFP-binding protein (VHH, nanobody) Chromotek Cat# gt-250 Methyl-b-cyclodextrin (MbCD) Sigma-Aldrich Cat# C4555 2-bromopalmitate (2-BP) Sigma-Aldrich Cat# 238422 Latrunculin B Sigma-Aldrich Cat# L5288 Human HDL Kalen Biomedical Cat# 770300-4 Human LDL Kalen Biomedical Cat# 770200-4 Nile Red Thermo Fisher Cat# N3013 Ezrin Inhibitor Calbiochem Cat# NSC668394 Triton X-100 Fisher Scientific Cat# BP151-500 DAPI Thermo Fisher Cat# D1306 Hoechst 33258 Thermo Fisher Cat# H21491 Cy3B NHS ester GE Healthcare Cat# PA63101 DyLight 650 NHS ester Thermo Fisher Cat# 62265 Alexa Fluor 488 (AF488) NHS ester Thermo Fisher Cat# A20000 Top-Fluor Cholesterol Avanti Polar Lipids Cat# 810255 Nile Red Sigma-Aldrich Cat# N3013 Acti-Stain 670 Phalloidin Cytoskeleton Cat# PHDN1 ProLong Diamond Antifade mountant Thermo Fisher Cat# P36961 Oligomers ACGT Corporation N/A CloneAmp Hifi PCR premix Takara Cat# 638500 DpnI restriction enzyme New England Biolabs Cat# R0176S 2-mercaptoethanesulfonate (MESNA) Sigma-Aldrich Cat# 63705 Wheat germ agglutinin (WGA)-AF647 Thermo Fisher Cat# W32466 Critical Commercial Assays GeneJet RNA Purification Kit Thermo Fisher Cat# K0731 Superscript VILO cDNA synthesis Kit Thermo Fisher Cat# 11754-010 (Continued on next page) e1 Developmental Cell 50, 1–13.e1–e5, August 5, 2019 .. REAGENT or RESOURCE SOURCE IDENTIFIER Lipofectamine LTX with Plus Reagent Thermo Fisher Cat# 15338100 FuGENE 6 Transfection Reagent Promega Cat# E2691 VIROMER Blue Transfection Reagent Lipocalyx Cat# VB-01LB-00 Taqman Fast Advanced Master Mix Thermo Fisher Cat# 4444557 QIAquick PCR purification kit Qiagen Cat# 28104 In-Fusion HD EcoDry cloning kit Takara Cat# 639690 Pierce Cell Surface Protein Isolation kit Thermo Fisher Cat# 89881 Experimental Models: Cell Lines Human female NCI-H295R ATCC Cat# CRL-2128 Hamster female CHO-K1 ATCC Cat# CCL-61 Human male HepG2 ATCC Cat# HB-8065 Human HAMEC (sex not known) ScienCell Cat# 7200 Human male HDLEC PromoCell Cat# C-12216 Experimental Models: Organisms/Strains Escherichia coli Stellar Competent Cells Clontech Cat# 636763 Oligonucleotides TaqMan gene expression assay total SR-B1 Thermo Fisher Cat# Hs00969821_m1 Custom TaqMan gene expression assay SR-B1 canonical: Forward: actatgcccagtacgtcctcctg; Reverse: ctccaaaataaatagcatttctcttggctccgg Thermo Fisher N/A Custom TaqMan gene expression assay SR-B1.1: Forward: actatgcccagtacgtcctcctg; Reverse: gtcctcaggaccttggctccgga Thermo Fisher N/A TaqMan gene expression assay CD81 Thermo Fisher Cat# Hs01002167_m1 TaqMan gene expression assay CDKN1A Thermo Fisher Cat# Hs00355782_m1 SR-B1 Stealth siRNA Thermo Fisher Cat# HSS101570 CD81 Stealth siRNA Thermo Fisher Cat# HSS101629 Stealth RNAi negative control duplexes Thermo Fisher Cat# 12935300 Recombinant DNA SR-B1-GFP Neculai et al., 2013 N/A SR-B1.1-GFP This paper N/A SR-B1 Neculai et al., 2013 N/A SR-B1.1 This paper N/A GFP-TMC This paper N/A GFP-TMC.1 This paper N/A SR-B1 PALM-/- This paper N/A SR-B1 MYRI-/- This paper N/A SR-B1 L413A This paper N/A SR-B1 L413A/L427A This paper N/A SR-B1 L441A/L448A/L455A This paper N/A SR-B1 G15L/G18L/G25L This paper N/A VapB-mCherry Zewe et al., 2018 Addgene D4H-mCherry Maekawa and Fairn, 2015 N/A Clathrin light chain-GFP Gaidarov et al., 1999 N/A tdEos-SR-B1 This paper N/A Software and Algorithms Volocity Perkin Elmer http://cellularimaging.perkinelmer.com/downloads/ detail.php?id=14 GraphPad Prism GraphPad Software https://www.graphpad.com/scientific-software/ prism/ (Continued on next page) Developmental Cell 50, 1–13.e1–e5, August 5, 2019 e2 .. REAGENT or RESOURCE SOURCE IDENTIFIER MATLAB MathWorks https://www.mathworks.com/products/matlab.html u-Track single particle tracking software Jaqaman et al., 2011 https://www.utsouthwestern.edu/labs/danuser/ software/ Huygens Professional Scientific Volume Imaging https://svi.nl/Huygens-Professional Zen software Zeiss https://www.zeiss.com/microscopy/int/products/ microscope-software/zen-lite.html Other ITS+Premix Culture Supplement Corning Cat# 354352 ECM medium ScienCell Cat# 1001 ECGM-MV2 medium PromoCell Cat# C-22022 Antibiotic-Antimycotic Solution (100x) Multicell Cat# 450-115-EL Chamlide Magnetic Chambers Live Cell Instrument Cat# CM-B18-1



    Similar Products

    cell lines primary human dermal lymphatic endothelial cells promocell 12216 experimental models  (PromoCell)
    96
    PromoCell cell lines primary human dermal lymphatic endothelial cells promocell 12216 experimental models
    Cell Lines Primary Human Dermal Lymphatic Endothelial Cells Promocell 12216 Experimental Models, supplied by PromoCell, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/12216+experimental+models/Human+Dermal+Lymphatic+Endothelial+Cells/pm37454290-140-14-22
    Average 96 stars, based on 1 article reviews
    cell lines primary human dermal lymphatic endothelial cells promocell 12216 experimental models - by Bioz Stars, 2026-09
    96/100 stars
    		  Buy from Supplier
    12216 experimental models  (TaKaRa)
    97
    TaKaRa 12216 experimental models
    12216 Experimental Models, supplied by TaKaRa, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/12216+experimental+models/Stellar+Competent+Cells/pm31231038-329-97-106
    Average 97 stars, based on 1 article reviews
    12216 experimental models - by Bioz Stars, 2026-09
    97/100 stars
    		  Buy from Supplier
    c12216 experimental models  (PromoCell)
    96
    PromoCell c12216 experimental models
    C12216 Experimental Models, supplied by PromoCell, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/12216+experimental+models/Human+Dermal+Lymphatic+Endothelial+Cells+(HDLEC)+juvenile+foreskin/pm34852224-245-192-190
    Average 96 stars, based on 1 article reviews
    c12216 experimental models - by Bioz Stars, 2026-09
    96/100 stars
    		  Buy from Supplier
    12216 experimental models  (PromoCell)
    96
    PromoCell 12216 experimental models
    12216 Experimental Models, supplied by PromoCell, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/12216+experimental+models/HDLEC-c+Human+Dermal+Lymphatic+Endothelial+Cells/pm31461654-286-96-94
    Average 96 stars, based on 1 article reviews
    12216 experimental models - by Bioz Stars, 2026-09
    96/100 stars
    		  Buy from Supplier

    Image Search Results